Comments
1 - 20 of 21 Comments Last updated Jan 19, 2013
First Prev
of 2
Next Last

Since: Dec 09

Auckland, New Zealand

|
Report Abuse
|
Judge it!
|
#1
Nov 19, 2012
 
Lost Weed

Nelson, New Zealand

|
Report Abuse
|
Judge it!
|
#2
Nov 19, 2012
 
hav,nt read the link netbanger but I had my suspiscions way back.. is he an Aluminati?

Since: Dec 09

Auckland, New Zealand

|
Report Abuse
|
Judge it!
|
#3
Nov 20, 2012
 
Whats Aluminati
Lost Weed

Nelson, New Zealand

|
Report Abuse
|
Judge it!
|
#4
Nov 20, 2012
 
netbanger wrote:
Whats Aluminati
sorry Illuminati..

Since: Dec 09

Auckland, New Zealand

|
Report Abuse
|
Judge it!
|
#5
Nov 20, 2012
 
Lost Weed wrote:
<quoted text> sorry Illuminati..
Oh that 1, i thought je was against them
Lost Weed

Nelson, New Zealand

|
Report Abuse
|
Judge it!
|
#6
Nov 20, 2012
 
netbanger wrote:
<quoted text>
Oh that 1, i thought je was against them
did you? well you just never know :)

Since: Jun 12

Location hidden

|
Report Abuse
|
Judge it!
|
#7
Nov 21, 2012
 
Hi David icke is a disinfo agent
Lost Weed

Nelson, New Zealand

|
Report Abuse
|
Judge it!
|
#8
Nov 21, 2012
 
Dishant wrote:
Hi David icke is a disinfo agent
this could be very true..

Since: Jun 12

Location hidden

|
Report Abuse
|
Judge it!
|
#9
Nov 21, 2012
 
@lost weed. It is true that david Icke is a disinfo agent. There are 7 types of researchers. 1) True researchers - like Alan Watt who come up with objective factual study and exposes the true machinery of the system 2) Extremists - who do give good information but provide extreame methods such as rioting etc which only helps the establishment 3) Exaggeraters - who keep exaggerating on some issues like secret societies and never cover private central banking , culture creation , dumbing down of society , media brainwashing etc 4) Gatekeepers - who never let their followers go beyond a certain level of understanding 5) Alien agendas - disinfo agents who do come with some good research and then decieve their followers by introducing alien myths 6) Reptilian shape shifter agenda same as alien the only difference being reptiles blamed instead. 7) New agers - who expose bits of the agenda and loop the followers back in the Agenda by providing New Age Spirituality as the solution. Points 5 , 6 , 7 clearly Applies on David Icke.

Since: Jun 12

Location hidden

|
Report Abuse
|
Judge it!
|
#10
Nov 22, 2012
 
The New World Order. Or The agenda of the Illuminati ( international
bankers , royal families , major polticians ) is the
compromise or abolition of [revealed] religion and
morals and replacing them with a collectivist,
socialist secular order. This [secular] order is
characterized with: centralized credit through a global central bank , abolition of all private
property, abolition of the family unit and tearing
of all natural familial bonds (husband-wife,
parent-child, child-mother, child-father), heavy progressive taxes (with supplemental welfare) to keep everyone just above the poverty line, abolition of all rights of inheritance, total control over all means of communication, confiscation of public lands, control of the means of production
(industry, food) and the practice of Eugenics
(removal of inferior or unwanted "stock" labeled
deceptively as "bioethics" and "sustainable
development" ).
All of this being bound together through a unified world religion which is the " New Age Spirituality " (that will accommodate , merge , compromise and dissolve [revealed] religions). This entire order is to be put into place, maintained and kept intact through a) integration and control of the world's economies, creating a tight interdependence, b) permanent "wars on
terror" (used to standardize the political and economical landscapes of " rogue " countries which are not yet run by a private, foreign, central bank and whose natural resources
provide them economic, political and cultural
independence) and c) an environmentalist religion
(under the threat of the "destruction" of the
planet" ) used to tax nations and societies into
slavery and to dominate every aspect of their
lives. This secular order is to be scientifically and
technologically managed.
Lost Weed

Nelson, New Zealand

|
Report Abuse
|
Judge it!
|
#11
Nov 22, 2012
 
Dishant wrote:
The New World Order. Or The agenda of the Illuminati ( international
bankers , royal families , major polticians ) is the
compromise or abolition of [revealed] religion and
morals and replacing them with a collectivist,
socialist secular order. This [secular] order is
characterized with: centralized credit through a global central bank , abolition of all private
property, abolition of the family unit and tearing
of all natural familial bonds (husband-wife,
parent-child, child-mother, child-father), heavy progressive taxes (with supplemental welfare) to keep everyone just above the poverty line, abolition of all rights of inheritance, total control over all means of communication, confiscation of public lands, control of the means of production
(industry, food) and the practice of Eugenics
(removal of inferior or unwanted "stock" labeled
deceptively as "bioethics" and "sustainable
development" ).
All of this being bound together through a unified world religion which is the " New Age Spirituality " (that will accommodate , merge , compromise and dissolve [revealed] religions). This entire order is to be put into place, maintained and kept intact through a) integration and control of the world's economies, creating a tight interdependence, b) permanent "wars on
terror" (used to standardize the political and economical landscapes of " rogue " countries which are not yet run by a private, foreign, central bank and whose natural resources
provide them economic, political and cultural
independence) and c) an environmentalist religion
(under the threat of the "destruction" of the
planet" ) used to tax nations and societies into
slavery and to dominate every aspect of their
lives. This secular order is to be scientifically and
technologically managed.
its all so interesting...

Since: Jun 12

Location hidden

|
Report Abuse
|
Judge it!
|
#12
Nov 22, 2012
 
@lost weed yeap its absolutely fascinating but unfortunately most people think its a conspiracy. Mainly because the mainstream media is in the pocket of the Illuminati. The globalist owned media keeps people distracted and decieved in Celebrities scandals , sports trivia , right vs left smokescreen ( both are the two wings of the same bird ), false enemies like Iran , etc. A good article that exposes the mainstream media is this http://vigilantcitizen.com/vigilantreport/min...
Lost Weed

Nelson, New Zealand

|
Report Abuse
|
Judge it!
|
#13
Nov 22, 2012
 
Dishant wrote:
@lost weed yeap its absolutely fascinating but unfortunately most people think its a conspiracy. Mainly because the mainstream media is in the pocket of the Illuminati. The globalist owned media keeps people distracted and decieved in Celebrities scandals , sports trivia , right vs left smokescreen ( both are the two wings of the same bird ), false enemies like Iran , etc. A good article that exposes the mainstream media is this http://vigilantcitizen.com/vigilantreport/min...
i know what you saying!!

Since: Jun 12

Location hidden

|
Report Abuse
|
Judge it!
|
#14
Nov 23, 2012
 
@lost weed i'am happy that at least some people like you are awake and know what really is happening. Where are you from btw ?? How do people around you react to when you bring these things into light ??
Lost Weed

Nelson, New Zealand

|
Report Abuse
|
Judge it!
|
#15
Nov 23, 2012
 
Have known this for quite some time.. he would,ve been under a bus long ago if he was for real.. I don,t bring it to light for people.. they have to awaken themselves I feel.. to much going on in the world at the moment and to much for them all to take in.. especially if I try and debunk Icke! its a waiting game really.. shifts in energy everything will reveal its true self at some stage..
Man from Atlantis

North Charleston, SC

|
Report Abuse
|
Judge it!
|
#16
Dec 17, 2012
 
-Piper- wrote:
LUUUULZ dude ! OP you've got not even teh slightest idea what the hell you talking about mate. Your made some pompous writings to make it sound scientifical but in fact its nothing more than a big pile of giberish without any sense (e.g. Xyognu Aryans). WTF?! LOLOLOLOLOL
100, 000 ago Q1* came out Levant to Northern China in Xinyang Provine where Q1a with L-M20 existed 40,000 in Tamil Indians and Q1a6 in 8000 years ago 12,000 in Elamo-Dravidian Neolithic farming people in Indus Valley and Nile Valley in Egypt and Ethiopia and Q1ab existed in Sumerians 4000 years ago when the Black Ethiopians with Q1a6 met the Q1a6 Elamite-Dravidian or Tocharian Gutians became the Abraham Jewish of Sumeria 2200 years ago and the ruled for about 100 years and Gutian Tocharians,but chase out the Middle East into Xinyang Province in 2200 B.C. By Babylonians. They were Sumerians Jews with the Sumeria Q1ab Q1b1a or Q-L245 that the Tocharian and and their descendant the Tocharian migrated to from Sumeria with Q1ab. One group went to back Xinyang Province back 2200 B. C. xiaohe the Caucasians She is 3,800 years old with mtDNA R1a1a and Y Chromosome Q1ab with B Rh negative, Tall, Jewish features, Witch Hat, may in fact be Lilith from Ur Sumeria Adam first Q1ab Q1b1a or Q-L245 Tocharian-Sumeria wife who banish by the J1 Babyonian Semitic, They also called them the Gutians who languages related to the Tocharians. So Lilith went to Xinyang Province in Tamir Basin 3800 years ago. Abraham who carried the Q1ab Q1b1a or Q-L245, with B Rh negative blood type who was Wizard when first to Kurdistan from Ur to Levant where Druze were and to Egypt to Yemen where King Solomon is Q1ab, Q1b1a or Q-L245, B Rh negative in tribe of Judah. The Levite descendant of Abraham from Ur Sumeria. Q1b1a or Q-L245 with M-232 and M271 and B Rh negative with Jewish Exilarch who by 500 B.C. intermarry with L-M20 haplgroup which is 40, 000 years Elamite-Dravidian Medes with Q1b1a or Q-L245 with M-232 and M271 and B Rh negative with Jewish Exilarch like Daniel or Zerubbabel in Cryus the Great with Archamenes Persians and Magi who Daniel who Q1b1a or Q-L245 with M-232 and M271 and B Rh negative with Jewish Exilarch was Chief of Occult Sciences and Rab Mag or Chief the Magi which created L-M11 haplogroup Persian Magi Priesthood in 2500 years when Darius who daughters were mtDNA L-M11 haplogroup or Persian Magi and Persian female Royal lineage which the combination of L-M20 of Medes and Q1b1a or Q-L245 with M-232 and M271 and B Rh negative. My Grandfather Major Frank Warren is L-M20 with L-M11 called L* haplogroup found in the Parsis. We have CdE/cde with B Rh negative from Parsis who from the Na-Dene Blackfoot Sioux Dakota who Cde/cde with A Rh negative and Cde/cde with B Rh negative and in Northeast Asia were Rh negative peak in Asia. B Rh negative mostly with A Rh negative in Xinyang Province in Tocharians in North China came with Q1b1a or Q-L245 xiaohe the Caucasians who B Rh negative and Red Hair, Green Eyes, Tall, Witch and Jewish all like Lilith from Sumeria where Q1b1a or Q-L245 originated 2200 years ago.
.
She is 3,800 years old, but she still turns heads
SEQ ID NO: 800) Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232. This STS also contains M217 site.

This clearly show that the first Aryan were Tocharian Jews who were Mixed Race Proto-Indo-European People. Tocharian or Kurgan are the people both Eastern Europe, Middle East especially in Ur Sumeria and Susa Iran, Xinyang Province with Eurasian Caucasian Tocharian originate who migrated to the Americas where the have Eskimo, Na-Dene and Peruvian American with Q haplogroup and various degree of ryr CdE/cde Rh negative blood type frequence same in my family who directly the Parsis in Karachi who from the Iraqi Jews or Exilarch descendant from Abraham who is Q1b1a or Q-L245
Man from Atlantis

North Charleston, SC

|
Report Abuse
|
Judge it!
|
#17
Dec 17, 2012
 
I don't know about the Klan but the real Nazi have no problem with this evidence and Tocharians because valid the Gemans not the Klan!
Man from Atlantis

North Charleston, SC

|
Report Abuse
|
Judge it!
|
#18
Dec 17, 2012
 
I don't know about the Klan but the real Nazi have no problem with this evidence and Tocharians because valid the Germans not the Klan!

Some of like the Tocharian are real and have taken over the world with Aryan Socialism.

And Some of are Semitic Blonde and Blue Eyed BSr!
Man from Atlantis

North Charleston, SC

|
Report Abuse
|
Judge it!
|
#19
Dec 17, 2012
 
I am not Klan and I am Tocharian Nazi
Man from Atlantis

North Charleston, SC

|
Report Abuse
|
Judge it!
|
#20
Dec 17, 2012
 
I know the Klan doesn't feel in their racist heart that is no such thing a Grey Aryan but the real Nazi don't feel that way!

You about St Anne or Virgin Mary, or Abraham the Tocharian or Lilith Tocharian who real Nazi or Belita of Jews the worship Aryan Son Gods and Goddress like Tocharians with L-M20 of Medes and Q1b1a or Q-L245 with M-232 and M271 and B Rh negative from Tocharians or Gutian Jew of Ur Sumerians or Kurds or Kur people Hell because Aryan people have been in hell for the last 12,000 years because Semitic people. Who released them? Me, The Grey Aryan, Wheatish Aryan, the Black Jewish Tocharians. Who are against J1 haplgroup Babylonian who chase the Tocharian-Gutian in Kurdistan with Yazidis or Jews and to Xinyang Province in Tarim Basin where xiaohe the Caucasians Who is 3,800 years old with mtDNA R1a1a and Y Chromosome Q1ab with B Rh negative, Tall, Jewish features, Witch Hat, may in fact be Lilith from Ur Sumeria Adam first Q1ab Q1b1a or Q-L245 Tocharian-Sumeria wife who banish by the J1 Babyonian Semitic.

Do you own result? We put Aryan back in power all of over the World even in Latin American with Aztec, Mayan, Incas and Quecha. We are true Nazis or Grey Aryan who being terrorize by the Klan, who know crap! about real Aryan or real white people. But very the racist people in Australia who very good deal of learn respect of the Australia Aboriginal people who came to India long time ago all blonde, Red and Black haired. These are real Aryans. or Proto-Neanderthal Aryan people also like Papau New Guineans. German people know who really are the Neanderthal ancestors, so does Thor Heyerdahl. He wasn't looking for the ancestor of his people in Mary Old English. He was in Oceania and Polynesia and South America to find the Aryan race. The Nazi were in Himalayas and North China to find their Aryan not among the Anglo-Saxon Protestants. There is reason why Aborignes when from no respect to apology from the Australian Government. Because know they are the Ancestor of their people who did come Chimpanzee out of Africa but form Gorilla out of Asia. WASP don't know these things but Nazi do! Nazi know that all Jews are Semitic and nor all originally Semitic. Jew where Originally, just like Jewish-Gypsy Persian Noble, I came from the original were Tocharian Aryans.

Tell me when this thread is updated: (Registration is not required)

Add to my Tracker Send me an email

First Prev
of 2
Next Last
Type in your comments below
Name
(appears on your post)
Comments
Characters left: 4000

Please note by clicking on "Post Comment" you acknowledge that you have read the Terms of Service and the comment you are posting is in compliance with such terms. Be polite. Inappropriate posts may be removed by the moderator. Send us your feedback.

•••
•••