I am a true Q haplogroup black Kurga...

I am a true Q haplogroup black Kurgan or Aryan.

Posted in the Weird Forum

First Prev
of 2
Next Last
Man from Atlantis

North Charleston, SC

#1 Dec 9, 2012
I am a true Q haplogroup black Kurgan or Aryan.

Q=1.9%- Typical of Northern Altaic populations.

A skull analysis of Xiongnu burials made by G.F. Debets found a distinct Paleo-Siberian type of Asian facial
appearance with "not a flat, but with not strongly protruding nose," somewhat similar to some North American
Indians (haplogroup Q). This type is represented on the embroidery from Noin-Ula.
Portraits found in the Noin-Ula excavations demonstrate other cultural evidences and influences, showing that
Chinese and Xiongnu art have influenced each other mutually. Some of these embroidered portraits in the Noin-Ula
kurgans also depict the Xiongnu with long braided hair with wide ribbons, which are seen to be identical with the
Turkic Ashina clan hair-style, while a later famous portrait of Kul Tikin (Tegin), the Kaghan of Celestial Turks
from the Ashina Clan, shows typical haplogroup Q facial features (The “Gold (Kagan’s)" clan of the ancient Türkic
dynastic tribe Ashina (< Hot.-Sak. ashsheina “blue”,"dark blue”) was called Shar-Duly (< Middle Persian zarr duli
“Golden bird Duli”,"Golden/Red Raven”). In that clan was born prince Kül-Tegin..)

Your Jews are more like Mongols than Magyars hence the Q haplogroups in Jews.

Hence Jews having Turan surnames like Khan (Genghiz Khan) like that Jewish sexual degenerate of the IMF Dominique Strauss Khan.

Jews have Turan surnames like Kagan (A Avar title like a king or Tsar)

Major Frank Warren mtDNA gtgtgccttc from Yemenite Jews from Q haplogroup and L-M11 haplogroup from Darius the Great and Persian Zoroastrians from Parsis
Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C
Study of an American Negro Family with the Rare Rh Genotype ryr (CdE/cde)
The very rare Rh genotype Ryr (CdE/cde) in a case of erythroblastosis foetalis.
rare r y (CdE) gene (=0.7%) in the Parsis is one of the most unique findings described
so far in any population of the world. In Parsis it is poplymorphic whereas it is just
sporadic in occurrence that too in a few populations only, the world over.
About 15% of Yemenite Jews belong to the Q1a3b haplogroup which is defined by the M242, M346 and M232 mutations. The Yemenite became the Exilarch Jews which the descend from 21th Exilarch Mar Abba who daughter Shushandukt Married Yazdegerd I who Yazdegerd III who J1b in B Rh negative descend from and his daughter Nazbanu from Pars mtDNA is L-M11 haplgroup with B Rh negative from gtgtgccttc from Yemenite Jews from Q haplogroup and are Rh Genotype ryr (CdE/cde) which came from the Q haplgroup Atalic Kagan or Kurgan Native American people in Northeast Asia related the Aluet who Genotype ryr (CdE/cde) related the Japanese Ainu and Inca Indians also related to Japanese Ainu with very high level or Genotype ryr (CdE/cde) and A- Rh negative Ainu Japan with so both the Aluet or Eskimos and Inca Indian related to the Ainu Altaic Kurgan people of Northeast Asia where Rh negative is at it Highest peak in Asia according to Genetics Cavalli Sforza of Standford University. So I am pure Rh negative and my ancestor are Rh negative Q haplogroup Native America Altaic Kurgan Aryan people. I am pure Aryan. I am Kurgan Highland, Kurgan is my prize. The Elamo-Dravidian were true Proto-Persian black and white Aryan Kurgan people.

at position 296 GroupVIII. Discovered while typing M232
Q1a3b M323 (Yemenite Jews only)

About 15% of Yemenite Jews belong to the Q1a3b haplogroup which is defined by the M242, M346 and M232 mutations.
Man from Atlantis

North Charleston, SC

#2 Dec 9, 2012
Virgin Mary is Q haplogroup 12,000 years old Shaman Queen Kurgan Jewish-Native American Women.
Man from Atlantis

North Charleston, SC

#3 Dec 9, 2012
Virgin Mary is Q haplogroup 12,000 years old Shaman Queen Kurgan Jewish-Native American Women.

She is 12,000 Shaman Kurgan Women
Man from Atlantis

North Charleston, SC

#4 Dec 9, 2012
Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232

Q1a3b M323 (Yemenite Jews only)

Q1a3b haplogroup (Yemenite Jews) has M271 and M232
L-M11 both Darius Persians Royalty and Yazdegerd III mtDNA L-M11 has M271 and M232

Yazdegerd III mtDNA L-M11 has M271 and M232 in Q haplogroup Kurgans and gtgccttc is the DNA sequence.

This my Grandfather mtDNA : L-M11 DNA sequence and it is Kurgans.

This mine and Virgin Mary family Kurgan mtDNA sequences.
Man from Atlantis

North Charleston, SC

#5 Dec 9, 2012
Kurgan mtDNA sequences of Kurgan Q1a3b in (Yemenite Jews)
doug

Greenfield, IN

#6 Dec 9, 2012
Man from Atlantis, you are aware, I assume, that the Q1a3b haplogroup of Yemenite Jews is a Y-chromosome haplogroup and not a MtDNA haplogroup. Obviously the Virgin Mary did not have a Y-chromosome. Are you referring to her father's family line?
Man from Atlantis

North Charleston, SC

#7 Dec 9, 2012
it matter wheather is Y Chromsome of Solomon when Q haplgroup Yemenite Jews or Exilarch married Persian L-M20 Royal Medes Women of Cyrus the Great in produce the mtDNA L-M11 which is carry the female line of Persian Royal family from Darius I daughter to Yazdegerd III daughther Nazbanu

Both M271 and M232 is found in Q1a3b in (Yemenite Jews) and Jewish Exilarch or Persian Jews and Persian Jewish female Nobility withi in Archeamenes Persian and Sassanian Persian Royal lineage.
Man from Atlantis

North Charleston, SC

#8 Dec 9, 2012
This genetic sequence gtgtgccttc with M271 and M232, which has to Pituitary Dwarfism which I have is found in both Q1a3b in Jews and L-M11 in Parsis or Jewish Sassanian Royal nobles from Karachi Sindh which called the Dwarfism of Sindh or GHRH-R or Growth Hormone Release Hormone Receptor gene which receptor Growth Hormone which cause aging so it is anti-aging and anti-cancer gene and only people it found our Yemenite Jews with Growth hormone deficiency IB. Solomon and Sheba descendant carry it to Ur Sumeria to the Pars Persia to family Karachi Pakistan in Parsis and Sindhi people who intermarried with Parsi.
Man from Atlantis

North Charleston, SC

#9 Dec 9, 2012
GHRH-R or Growth Hormone Release Hormone Receptor gene which receptor Growth Hormone which cause aging is found in some Jews and Parsi who are 98% genetically alike but the only people GHRH-R is found is Amerindians people in South America with Q haplogroup.

Level 6

Since: Jan 12

Location hidden

#10 Dec 9, 2012
here.. have some gooey butter cookies... take a chill pill

all people right?
Man from Atlantis

North Charleston, SC

#11 Dec 10, 2012
Scytho-Siberian Kurgan the Atalic mixed with Chuchi in Siberia with HLA DRB1 0802 DQA1 0401 DQB1 0402, also found in Kurgans, Yemenite Jews, Ethiopian Jews, Zoroastrian from Pars and Yazds and Karachi.

HLA DRB1 0802 DQA1 0401 DQB1 0402 in Eskimo in Alaska and Quechua in Peru Native Americans with high Rh negative level.

Time Frame: Middle of the 5th century BC
Region: Kosh Agash region, Altai Republic
Race / Culture: Scythian (Sytho-Siberian)
Project Type: Ancient Sarcophagus / Scytho-Siberian Kurgan
Man from Atlantis

North Charleston, SC

#12 Dec 10, 2012
The very rare Rh genotype Ryr (CdE/cde) in a case of erythroblastosis foetalis.

I have the Ryr (CdE/cde) from the Ariadoi Gypsy who came from the Parsis Sassanian Nobles from Karachi who came to Karachi from Parsi in 714 A.D.

Ryr (CdE/cde)came from the Kurgan who came from Northeast Asia and the Aluet Ryr (CdE/cde) and the
Quechua in Peru from the Andeans with high level of Ryr (CdE/cde)
Monocan

Tampa, FL

#13 Friday Jun 19
Hello Man of Atlantis. Thank you for the incredible grasp on this rh neg blood topic.

I am new to the understanding of my own B- conundrum. I can see I will be studying your info for help with this. Just want to thank you and acknowledge all your efforts.

“Forehead wrinkle”

Since: Dec 10

Homefries

#14 Monday Jun 22
TWO-STROKE PRINCIPLES

Although a two-stroke engine has less moving parts than a four-stroke engine, a two-stroke is a complex engine because it relies on gas dynamics. There are different phases taking place in the crankcase and in the cylinder bore at the same time. That is how a two-stroke engine completes a power cycle in only 360 degrees of crankshaft rotation compared to a four-stroke engine which requires 720 degrees of crankshaft rotation to complete one power cycle. These four drawings give an explanation of how a two-stroke engine works.

1) Starting with the piston at top dead center (TDC 0 degrees) ignition has occurred and the gasses in the combustion chamber are expanding and pushing down the piston. This pressurizes the crankcase causing the reed valve to close. At about 90 degrees after TDC the exhaust port opens ending the power stroke. A pressure wave of hot expanding gasses flows down the exhaust pipe. The blow-down phase has started and will end when the transfer ports open. The pressure in the cylinder must blow-down to below the pressure in the crankcase in order for the unburned mixture gasses to flow out the transfer ports during the scavenging phase.

2) Now the transfer ports are uncovered at about 120 degrees after TDC. The scavenging phase has begun. Meaning that the unburned mixture gasses are flowing out of the transfers and merging together to form a loop. The gasses travel up the back side of the cylinder and loops around in the cylinder head to scavenge out the burnt mixture gasses from the previous power stroke. It is critical that the burnt gasses are scavenged from the combustion chamber, in order to make room for as much unburned gasses as possible. That is the key to making more power in a two-stroke engine. The more unburned gasses you can squeeze into the combustion chamber, the more the engine will produce. Now the loop of unburned mixture gasses have traveled into the exhaust pipe's header section. The gasses aren't lost because a compression pressure wave has reflected from the end of the exhaust pipe, to pack the unburned gasses back into the cylinder before the piston closes off the port. This is the unique super-charging effect of two-stroke engines. The main advantage of two-stroke engines is that they can combust more volume of fuel/air mixture than the swept volume of the engine. Example: A 125cc four-stroke engine combusts about 110cc of F/A gasses but a 125cc two-stroke engine combusts about 180cc of F/A gasses.

“Forehead wrinkle”

Since: Dec 10

Homefries

#15 Monday Jun 22
3) Now the crankshaft has rotated past bottom dead center (BDC 180 degrees) and the piston is on the upstroke. The compression wave reflected from the exhaust pipe is packing the unburned gasses back in through the exhaust port as the piston closes off the port the start the compression phase. In the crankcase the pressure is below atmospheric producing a vacuum and a fresh charge of unburned mixture gasses is flowing through the reed valve into the crankcase.

4) The unburned mixture gasses are compresses and just before the piston reaches TDC, the ignition system discharges a spark causing the gasses to ignite and start the process all over again.

“Forehead wrinkle”

Since: Dec 10

Homefries

#16 Monday Jun 22
CYLINDER PORTING

The cylinder ports are designed to produce a certain power characteristic over a fairly narrow rpm band. Porting or tuning is a metal machining process performed to the cylinder ports (exhaust & transfers) that alters the timing, area size, and angles of the ports in order to adjust the power band to better suit the rider's demands. For example, a veteran trail rider riding an RM250 in the Rocky mountain region of the USA will need to adjust the power band for more low end power because of the steep hill climbs and the lower air density of higher altitudes. The only way to determine what changes will be needed to the engine is by measuring and calculating the stock engine's specifications. The most critical measurement is termed port-time-area. This term is a calculation of a port's size area and timing in relation to the displacement of the engine and the rpm. Experienced tuners know what the port-time-area values of the exhaust and transfer ports should be for an engine used for a particular purpose. In general, if a tuner wants to adjust the engine's power band for more low to mid range he would do the following things. Turn down the cylinder base on a lathe to increase the effective stroke (distance from TDC to exhaust port opening). This also retards the exhaust port timing and shortens the duration and increases the compression ratio. Next the transfer ports should be narrowed and re-angled with epoxy to reduce the port-time-area for an rpm peak of 7,000 rpm. The rear transfer ports need to be re-angled so they oppose each other rather than pointing forward to the exhaust port. This changes the loop scavenging flow pattern of the transfer ports to improve scavenging efficiency at low to mid rpm (2,000 to 5,000 rpm). An expert rider racing mx in England would want to adjust the power band of an RM250 for more mid to top end power. The cylinder would need to be tuned radically different than for trail riding.

Here is an example. The exhaust port would have to be raised and widened to change the port-time-area peak for a higher rpm (9,000 rpm). For either of these cylinder modifications to be effective, other engine components would also need to be changed to get the desired tuning effect.

“Forehead wrinkle”

Since: Dec 10

Homefries

#17 Monday Jun 22
CYLINDER HEAD

Cylinder heads can be reshaped to change the power band. Generally speaking, a cylinder head with a small diameter and deep combustion chamber, and a wide squish band (60% of the bore area). Combined with a compression ratio of 9 to 1 is ideally suited for low to mid range power. A cylinder head with a wide shallow chamber and a narrow squish band (35-45% of bore area) and a compression ratio of 8 to 1, is ideally suited for high rpm power.

There are many reasons why a particular head design works for certain types of racing. For example; a head with a wide squish band and a high compression ratio will generate high turbulence in the combustion chamber. This turbulence is termed Maximum Squish Velocity, MSV is rated in meters per second (m/s). A cylinder head designed for supercross should have an MSV rating of 28m/s. Computer design software is used to calculate the MSV for head designs. In the model tuning tips chapters of this book, all the head specs quoted have MSV ratings designed for the intended power band changes.
Parden Pard

Whitehall, PA

#18 Wednesday Jun 24
DILF wrote:
CYLINDER HEAD
Cylinder heads can be reshaped to change the power band. Generally speaking, a cylinder head with a small diameter and deep combustion chamber, and a wide squish band (60% of the bore area). Combined with a compression ratio of 9 to 1 is ideally suited for low to mid range power. A cylinder head with a wide shallow chamber and a narrow squish band (35-45% of bore area) and a compression ratio of 8 to 1, is ideally suited for high rpm power.
There are many reasons why a particular head design works for certain types of racing. For example; a head with a wide squish band and a high compression ratio will generate high turbulence in the combustion chamber. This turbulence is termed Maximum Squish Velocity, MSV is rated in meters per second (m/s). A cylinder head designed for supercross should have an MSV rating of 28m/s. Computer design software is used to calculate the MSV for head designs. In the model tuning tips chapters of this book, all the head specs quoted have MSV ratings designed for the intended power band changes.
GET your Rice burner OFF the street,,and off my lawn,,,sheshhh,,, I'm an American 4 stroke man,,,???(squish this)
(nothin personal dilf,,just aiding you with mermaid mans Diarrheatic shpeel)(boy needs to get laid,,say)

“Right click Left click Yay!”

Level 7

Since: Dec 10

Nehwon

#19 Wednesday Jun 24
Somewhere out there, there's a group of people trying to think up a name for their band. They need to read this thread...

True Blue and the Q Haplogroup
Kaghan and the Celestial Turks
Shushandukt Married Yazdegerd
Position 296
M242, M346, M232 And A Drummer
mtDNA Bitcoin Exchange
I am Jack's Pituitary Dwarfism
Ariadoi Gypsy Girl from Ipanema

My personal favorite is:

Spider and the Maximum Squish Velocity
Parden Pard

Whitehall, PA

#20 Thursday Jun 25
greymouser wrote:
Somewhere out there, there's a group of people trying to think up a name for their band. They need to read this thread...
True Blue and the Q Haplogroup
Kaghan and the Celestial Turks
Shushandukt Married Yazdegerd
Position 296
M242, M346, M232 And A Drummer
mtDNA Bitcoin Exchange
I am Jack's Pituitary Dwarfism
Ariadoi Gypsy Girl from Ipanema
My personal favorite is:
Spider and the Maximum Squish Velocity
I like "Squish Disrespect,,(yes there is a short version)"

Tell me when this thread is updated:

Subscribe Now Add to my Tracker
First Prev
of 2
Next Last

Add your comments below

Characters left: 4000

Please note by submitting this form you acknowledge that you have read the Terms of Service and the comment you are posting is in compliance with such terms. Be polite. Inappropriate posts may be removed by the moderator. Send us your feedback.

Weird Discussions

Title Updated Last By Comments
Make A Sentance out of a 5 letter word. (Nov '09) 1 min Hoosier Hillbilly 32,438
usa women's scoccer 3 min Denny CranesPlace 13
~`*`~ Create a sentence using the 'letters' of ... (Oct '12) 6 min Hoosier Hillbilly 2,480
News Evolution vs. Creation (Jul '11) 7 min DanFromSmithville 169,007
El's Kitchen (Feb '09) 13 min SLACK 41,457
For Dear FlowerChild (Dec '07) 25 min Denny CranesPlace 24,427
**3 Syllable Word Game - A-Z** (Jun '12) 35 min Zani Grey 835
motorcycle traveling stories 3 hr Sublime1 1,253
What song are you listening to right now? (Apr '08) 7 hr Wolftracks 165,529
More from around the web