Yemenite Jew Male-Limited Precious P...

Yemenite Jew Male-Limited Precious Puberty came from Axolot and Mayan Indians.

Posted in the Weird Forum

Man from Atlantis

Irmo, SC

#1 Nov 30, 2012
Yemenite Jew Male-Limited Precious Puberty came from Axolot and Mayan Indians.

Ancestor Q1a3a in Mayan Amerindians and Na-Dene in Sioux or Algoquin and Altailic Mongol like the Ainu in Japan. The Altailian Mongols with Q haplogroup settle in Northeast Asia and the Aral Sea and they also Afshars, also called Avshar are a branch of the Turkic Oghuz groups the most settle in Azeribaijan or Vaspurkhan and Kerman and Pars. The Afshar are the Pars or true Persian or Arianoi who originated. The Afshar had M11 from the Banu Sassan or Persian Gypsies that originated from Pars Persia and when in to exile in Deval or Karachi Pakistan until 1010 when the last Zoroastrian King of Sindh was killed and they then went into exile in Vaspurkhan or Iranian-Armenians to Antolia or Turkish part of Armenia in the village of Afshars in Turk and to Bulgaria where both L-M11 and Q are from Lom Bulgarian Gypsies then finally Romania in the Olt or Oltenia the old country.
Now,(GTCGCTTC) with L-M11 is related to Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232
or GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 and M232

About 15% of Yemenite Jews belong to the Q1a3b haplogroup which is defined by the M242, M346 and M232 mutations.
GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801 is related Yemenite Jews

H3 represents a smaller fraction of European genome than H1 but has a somewhat similar distribution with peak among Basques (13.9%), Galicians (8.3%) and Sardinians (8.5%). Its importance decreases towards the northeast of the continent though.[1] Studies have suggested haplogroup H3 is highly protective against AIDS progression.[12]

GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801 is related Yemenite Jews
M271 is a new member of Subgroup H3. H3 haplogroup came from pure Jews with both L and Q haplogroup with M271 which people with L-M11 haplgroup has the same Highly protective against AIDS progression.

GTCGCTTC) with L-M11 is related to actatacttcttttgt(GTCGCTTC )(SEQ ID NO: 801 is related Yemenite Jews and
GTCGCTTC Major Frank Warren L haplogroup mtDNA sequence for Dwarfism of Sindh. Neoteny
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B genes is responsible for pupation (the stage in the development of an insect in which it lies in repose and from which it eventually emerges in the winged form) in

TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty which people like me reach maturation at the age of years old. The gene is called GHRH-R which was Yemenite Jews carried to Ur Sumeria and to Persian Sassanian Royal with Exilarch Jewish(Yemenite Jews blood of Solomon and Sheba son Menelik. Nazbanu the daughther of Yazdegerd III from Pars carried L-M11 with TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty to Deval or Karachi in Sindh Province in now Pakistan is now called the Dwarfism of Sindh which is Male-Limited Precious Puberty without Luten related causes.

TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B came from Mayan Indian which they got from the axolotl or Giant Tadpole which have Male-Limited Precious Puberty
TGGTCATCCTTTGTCGCTTC (sense, position 759)
Chironomus tentans 7108 7153 3959 C.tentans Sp38-40.A and Sp38-40.B genes.
Man from Atlantis

Irmo, SC

#2 Nov 30, 2012
This also the proof that the Mormons were right at the least the about Yemenite Jews who descend from the Ancestor Q1a3a in Mayan who came to the Aral Sea and Sumeria and the Jews brought it the Yemen in which the Yemenite Jews. I am descend from Solomon and Sheba son who was a Yemenite Jews with HLA-A2901, HLA-B4201, DRB1*0302 and HLA-A3001, HLA-B8101, DRB1*0802(Amerindian Mayan) and DR52 (Amerindian Mayans) DRB3*0101(Amerindian Mayans) with B Rh negative in Sumeria with Native American Mayan Neanderthal in the America mixed with Rh negative Neanderthal from Sumeria both Neanderthals.
Man from Atlantis

Irmo, SC

#3 Nov 30, 2012
Why is DNA evidence ignored when it coincides with the Book of Mormon?
It is an indisputable fact now that men in the Middle East; Jews and Arabs, and most Native Americans share the M346 Y-chromosome mutation. The distribution of the M346 mutation makes it obvious that the closest paternal relatives of American Indians live today in the Middle East, India and Europe and not in East Asia.

Using observed mutation rates, men of American Indian and Arab origin belonging to the Q1a3 have a common ancestor that lived within the last 3000 years. You can easily find them on Y-search.
Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232
Q1a3b M323 (Yemenite Jews only)

About 15% of Yemenite Jews belong to the Q1a3b haplogroup which is defined by the M242, M346 and M232 mutations.
2 years ago
Q M242
...Q1 P36.2, L232, L273, L274
......Q1a MEH2
.........Q1a1 M120, N14, M265
.........Q1a2 M25, M143
.........Q1a3 M346, L56, L57
..........Q1a3a L53, L54, L55, L213, L331
..........Q1a3a1 M3 (AmerIndian only)
..........Q1a3a1a M19
..........Q1a3a1b M194
..........Q1a3a1c M199, P106, P292
..........Q1a3a2 L191 (AmerIndian only)
..........Q1a3a3 L330, L334 (Europeanů)
..........Q1a3a3a L329, L332, L333 (1 French)
..........Q1a3a4 L400, L401 (1 AmerIndian)
..........Q1a3b M323 (Yemenite Jews only)
.........Q1b M378 (Ashkenazi Jews)
..........Q1b1 L245
..........Q1b1a L272

Virtually all of this reaearch has been done by non-LDS scientists, which is the best way to let the truth come out as it eventually will.

H3 represents a smaller fraction of European genome than H1 but has a somewhat similar distribution with peak among Basques (13.9%), Galicians (8.3%) and Sardinians (8.5%). Its importance decreases towards the northeast of the continent though.[1] Studies have suggested haplogroup H3 is highly protective against AIDS progression.[12]
M271 is a new member of Subgroup H3.
Man from Atlantis

Irmo, SC

#4 Nov 30, 2012
This is not only clear the pure Jews have Native American Origins but they have original Mayan orgins who they Lakota Sioux are related to the White Buffalo Calf Women who is Native American Jew and Many reincarnation are Whope (Meteorite)in Sioux or the White Buffalo Calf Women who is the Spine of the Bison or Heart of Orion Belt. She is Lilith in Sumeria, Durga in India, Anahita in Persia, Virgin Mary for Jewish Christians and Isis in Egypt. They are the same reincarnation of the same Native American Jewish women. I am her direct descendant I have the DRB1*0802(Amerindian Mayan) and DR52 (Amerindian Mayans) DRB3*0101(Amerindian Mayans

I was born with Male-Limited Precious Puberty from Yemenite Jews(Solomon and Sheba family)

I have M271 which is subgroup of H3 and H3 is highly protective against AIDS progression. But was still target with HIV by the white people and and black people in the country related to cro-magnon who doesn't the Mayan Neanderthal Immunity to HIV progression that alot of Amerindian people have which I got from my Native American Jews ancestors.

“New & Improved..”

Level 8

Since: Oct 07

Formerly From Kenya

#5 Nov 30, 2012
I believe I just met the foreman from the Tower of Babel.

Tell me when this thread is updated:

Subscribe Now Add to my Tracker

Add your comments below

Characters left: 4000

Please note by submitting this form you acknowledge that you have read the Terms of Service and the comment you are posting is in compliance with such terms. Be polite. Inappropriate posts may be removed by the moderator. Send us your feedback.

Weird Discussions

Title Updated Last By Comments
Denny Crain's Place (May '10) 3 min Denny CranesPlace 24,109
What song are you listening to right now? (Apr '08) 7 min Mister_ E 220,944
Last 3 Letters into 3 new words. (Dec '08) 13 min Concerned_American 62,115
News The key to a healthy old age - get a dog 14 min Parden Pard 3
Poll What are you thinking right now? (May '08) 17 min Sublime1 4,677
Post how you feel (Oct '12) 18 min Sublime1 562
News Michael Phelps vs. a shark: The bizarre history... 34 min ShudderPhaartss 13
What Turns You Off? (Jan '17) 37 min Yournotgoingtobel... 994
A to Z songs by title or group! (Dec '16) 3 hr Joi C 2,164
More from around the web