Lets put end to who is pure white and...

Lets put end to who is pure white and Aryan once and for all!

Posted in the Weird Forum

Man from Atlantis

Irmo, SC

#1 Dec 13, 2012
Lets put end to who is pure white and Aryan once and for all!

B blood type in Gorilla. DRB3*0101 in Gorilla and a very few Gorilla are infact Rh D- negative or pure Rh negative. Northeast Asia is where Rh negative reaches it peek in Xiongnu Q haplogroup people. Which came found all the with Blackfeet Sioux Dakota with A Ryr CdE/cde and the Andes Quecha O Ryr Cde/cde but that not pure B blood type Rh negative Gorilla of little foot and Bigfoot blood type that would be Yeti in Himalayas with B Blood type, Ryr CdE/cde, DR52, DRB3*0101 and Virgin Mary is a direct descendant of Yeti form the Himalayas with B blood Ryr CdE/cde, DR52, DRB3*0101. Yet is a pure Ryr CdE/cde B Blood type Homo Erectus the descend from Gorilla Homonid species from Gorilla like Homo Hobbit 1.8 million years ago in the Flores Islandes in Indonesia in Southeast Asia. This is ancestor of Neanderthal but unlike A blood type and O Blood type. B type Blood type Neanderthal are pure Caucasians, why because they B blood type Gorilla, B Blood Homo Erectus, B Rh negative blood type Gorilla or Cde/cde which was created in the Himalayas when both the Xiongnu Aryan tribe and the Yet B and B – Blood type came from. f;b0b2b3b4b5bstcde pure Caucasian haplotype which on found not in the Basque O- Blood with DRB3*0202(Chimpanzee) or the A- Saami with DRB3*0202 in the Cro-magnon(Chimpanzee blood) but the pure f;b0b2b3b4b5bstcde Caucasian Haplotype is found originally only B Rh negative from Tocharians and Xiongu Aryans tribe Proto-Indo-European from 12,000 years. So let put end to Pure Caucasian B S, once and for all!

If you don’t have B Blood type, Ryr CdE/cde, DR52, DRB3*0101 like Parsis from Pars do then you are not a pure Caucasian! Your something else white but not pure Caucasian. I happen to be B blood Ryr CdE/cde, DR52, DRB3*0101. Yet is a pure Ryr CdE/cde B Blood type Homo Erectus the descend from Gorilla Homonid species from Gorilla like Homo Hobbit 1.8 million years ago in the Flores Islandes in Indonesia in Southeast Asia. Blonde Hair and Blue just don’t cut it nor belong in to the Klan, Neo-Nazi, Hell Angel who whatever white hate organization. Let the Nazi check my research and see if I am not 100% Right! gtgccttc with 296 GroupVIII originated in Neanderthal in Paupa New Guinea and Australia where Neanderthal first came from. Not Europe.

Now,(GTCGCTTC) with L-M11 is related to Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232
or GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 and M232
About 15% of Yemenite Jews belong to the Q1a3b haplogroup which is defined by the M242, M346 and M232 mutations.
Man from Atlantis

Irmo, SC

#2 Dec 13, 2012
https://www.google.com/search...

Tocharian Shaman White Women
Man from Atlantis

Irmo, SC

#3 Dec 13, 2012
Sam

Columbus, OH

#4 Dec 13, 2012
I'd just be happy if we could put an end to all of this f**king SPAM!!!!

Level 6

Since: Jun 09

Location hidden

#5 Dec 13, 2012
Everyone knows the true test of Aryan descent is whether or not you look good in lederhosen.
Man from Atlantis

Irmo, SC

#6 Dec 13, 2012
This is what I saw when I saw Anahita in August 12th 2003 during the week of the Perseud Meteor Shower

She look very similar to this Tocharian Pure Caucasian Women

and Also very Similar to Gabriela Sabatini the Argentine

http://24.media.tumblr.com/tumblr_me2zrfrAPX1...

http://i2.listal.com/image/1848785/600full-ga...

http://www.mygen.com/images/Shaman_Woman_Pict ...

Tocharian Shaman White Women

Then later that week the Gods started to appearing; first I push a shopping Kart down to the end the store, where there was nobody there and I turn around and I saw a very tall women who look like Argentinian Tennis Star Gabriela Sabatini because was very tall but this women saw was much Taller about 7 feet or more, Stern face, She had same Jewish beautiful features like Gabriela who of Jewish descent too. Her nose was especially Jewish like mine. She was dress combine of a Indian Maharani with gold and silver embroidery and bejewel I don't if she had crow or not be she also had dress like the Native American Pocahontas with Native American dress with fringes on the arms of the dress and fringes on the bottom of the dress made out animal or beaver skins with beaver skin boots with Durga earring in her nose. Now, long before I taught it was the Hindu Goddess Durga but the Description that I describe before and the one down below is exactly what I saw in that store what is describe in the Anahita Yasht and person that wrote that description of Anahita in the Yasht actually saw her like I did. Now I just read about Anahita in Avestan Yashts just a couple of days ago and this is what I saw that day. Anahita or Durga who are the same both are married Varuna or Ahura Mazda.

That what I Zoroaster discribe when he saw Goddess Anhahita and or Virgin Mary

126.'Ardvi Sura Anahita, who stands carried forth in the shape of a maid, fair of body, most strong, tall-formed, high-girded, pure, nobly born of a glorious race, wearing along her.... a mantle fully embroidered with gold;
127.'Ever holding the baresma in her hand, according to the rules, she wears square golden earrings on her ears bored, and a golden necklace around her beautiful neck, she, the nobly born Ardvi Sura Anahita; and she girded her waist tightly, so that her breasts may be well-shaped, that they may be tightly pressed.
128.'Upon her head Ardvi Sura Anahita bound a golden crown, with a hundred stars, with eight rays, a fine ...., a well-made crown, in the shape of a ...., with fillets streaming down.
129.'She is clothed with garments of beaver, Ardvi Sura Anahita; with the skin of thirty beavers of those that bear four young ones, that are the finest kind of beavers; for the skin of the beaver that lives in water is the finest-colored of all skins, and when worked at the right time it shines to the eye with full sheen of silver and gold.

“I know where you are,”

Level 8

Since: Jun 08

Right here under my thumb

#7 Dec 13, 2012
"Lets put end to who is pure white"

Only after Labor Day.

“"*" Always Thinking "*"”

Level 8

Since: Nov 12

Location hidden

#8 Dec 13, 2012
Sam wrote:
I'd just be happy if we could put an end to all of this f**king SPAM!!!!
Sam says

“"*" Always Thinking "*"”

Level 8

Since: Nov 12

Location hidden

#9 Dec 13, 2012

“It's all part of my charm.....”

Level 8

Since: May 12

Location hidden

#10 Dec 13, 2012
Man from Atlantis wrote:
This is what I saw when I saw Anahita in August 12th 2003 during the week of the Perseud Meteor Shower
She look very similar to this Tocharian Pure Caucasian Women
and Also very Similar to Gabriela Sabatini the Argentine
http://24.media.tumblr.com/tumblr_me2zrfrAPX1...
http://i2.listal.com/image/1848785/600full-ga...
http://www.mygen.com/images/Shaman_Woman_Pict ...
Tocharian Shaman White Women
Then later that week the Gods started to appearing; first I push a shopping Kart down to the end the store, where there was nobody there and I turn around and I saw a very tall women who look like Argentinian Tennis Star Gabriela Sabatini because was very tall but this women saw was much Taller about 7 feet or more, Stern face, She had same Jewish beautiful features like Gabriela who of Jewish descent too. Her nose was especially Jewish like mine. She was dress combine of a Indian Maharani with gold and silver embroidery and bejewel I don't if she had crow or not be she also had dress like the Native American Pocahontas with Native American dress with fringes on the arms of the dress and fringes on the bottom of the dress made out animal or beaver skins with beaver skin boots with Durga earring in her nose. Now, long before I taught it was the Hindu Goddess Durga but the Description that I describe before and the one down below is exactly what I saw in that store what is describe in the Anahita Yasht and person that wrote that description of Anahita in the Yasht actually saw her like I did. Now I just read about Anahita in Avestan Yashts just a couple of days ago and this is what I saw that day. Anahita or Durga who are the same both are married Varuna or Ahura Mazda.
That what I Zoroaster discribe when he saw Goddess Anhahita and or Virgin Mary
126.'Ardvi Sura Anahita, who stands carried forth in the shape of a maid, fair of body, most strong, tall-formed, high-girded, pure, nobly born of a glorious race, wearing along her.... a mantle fully embroidered with gold;
127.'Ever holding the baresma in her hand, according to the rules, she wears square golden earrings on her ears bored, and a golden necklace around her beautiful neck, she, the nobly born Ardvi Sura Anahita; and she girded her waist tightly, so that her breasts may be well-shaped, that they may be tightly pressed.
128.'Upon her head Ardvi Sura Anahita bound a golden crown, with a hundred stars, with eight rays, a fine ...., a well-made crown, in the shape of a ...., with fillets streaming down.
129.'She is clothed with garments of beaver, Ardvi Sura Anahita; with the skin of thirty beavers of those that bear four young ones, that are the finest kind of beavers; for the skin of the beaver that lives in water is the finest-colored of all skins, and when worked at the right time it shines to the eye with full sheen of silver and gold.
So...does this mean you're a honky vampire?*blinks*

Btw...I'm Rh negative. Does that make us... blood related? O.o

lol

“Big Sur”

Level 8

Since: Jun 11

Location hidden

#11 Dec 13, 2012
Sam wrote:
I'd just be happy if we could put an end to all of this f**king SPAM!!!!
AGREED!

“It's all part of my charm.....”

Level 8

Since: May 12

Location hidden

#12 Dec 13, 2012
Man from Atlantis wrote:
This is what I saw when I saw Anahita in August 12th 2003 during the week of the Perseud Meteor Shower
She look very similar to this Tocharian Pure Caucasian Women
and Also very Similar to Gabriela Sabatini the Argentine
http://24.media.tumblr.com/tumblr_me2zrfrAPX1...
http://i2.listal.com/image/1848785/600full-ga...
http://www.mygen.com/images/Shaman_Woman_Pict ...
Tocharian Shaman White Women
Then later that week the Gods started to appearing; first I push a shopping Kart down to the end the store, where there was nobody there and I turn around and I saw a very tall women who look like Argentinian Tennis Star Gabriela Sabatini because was very tall but this women saw was much Taller about 7 feet or more, Stern face, She had same Jewish beautiful features like Gabriela who of Jewish descent too. Her nose was especially Jewish like mine. She was dress combine of a Indian Maharani with gold and silver embroidery and bejewel I don't if she had crow or not be she also had dress like the Native American Pocahontas with Native American dress with fringes on the arms of the dress and fringes on the bottom of the dress made out animal or beaver skins with beaver skin boots with Durga earring in her nose. Now, long before I taught it was the Hindu Goddess Durga but the Description that I describe before and the one down below is exactly what I saw in that store what is describe in the Anahita Yasht and person that wrote that description of Anahita in the Yasht actually saw her like I did. Now I just read about Anahita in Avestan Yashts just a couple of days ago and this is what I saw that day. Anahita or Durga who are the same both are married Varuna or Ahura Mazda.
That what I Zoroaster discribe when he saw Goddess Anhahita and or Virgin Mary
126.'Ardvi Sura Anahita, who stands carried forth in the shape of a maid, fair of body, most strong, tall-formed, high-girded, pure, nobly born of a glorious race, wearing along her.... a mantle fully embroidered with gold;
127.'Ever holding the baresma in her hand, according to the rules, she wears square golden earrings on her ears bored, and a golden necklace around her beautiful neck, she, the nobly born Ardvi Sura Anahita; and she girded her waist tightly, so that her breasts may be well-shaped, that they may be tightly pressed.
128.'Upon her head Ardvi Sura Anahita bound a golden crown, with a hundred stars, with eight rays, a fine ...., a well-made crown, in the shape of a ...., with fillets streaming down.
129.'She is clothed with garments of beaver, Ardvi Sura Anahita; with the skin of thirty beavers of those that bear four young ones, that are the finest kind of beavers; for the skin of the beaver that lives in water is the finest-colored of all skins, and when worked at the right time it shines to the eye with full sheen of silver and gold.
Interesting fact for you...
A higher percentage of Rh-negative people claim to have been abducted by aliens than that of Rh-positive people.

Read more: Strange Facts About RH Negative Blood | eHow.com http://www.ehow.com/facts_5552003_strange-rh-...

It's true too! One night I was abducted by aliens, the mexican variety. They forced me into a limo and took me to many strange bars that night. Very friendly aliens.=)

Anyways, I've read many of your posts and I'm wondering if your next post will be about your history of anal probes and intergalatic travel? I look forward to your next installment, cousin.=D

Tell me when this thread is updated:

Subscribe Now Add to my Tracker

Add your comments below

Characters left: 4000

Please note by submitting this form you acknowledge that you have read the Terms of Service and the comment you are posting is in compliance with such terms. Be polite. Inappropriate posts may be removed by the moderator. Send us your feedback.

Weird Discussions

Title Updated Last By Comments
News Trump's bizarre claim that the Clinton email co... 5 min freedom2016 984
News Evolution vs. Creation (Jul '11) 6 min Snap 216,628
What song are you listening to right now? (Apr '08) 8 min Winter 206,909
El's Kitchen (Feb '09) 20 min Winter 67,104
Start a sentence in alphabetical order.. 24 min Princess Hey 1,571
Word Association 2 (Sep '13) 30 min Jennifer Renee 22,155
Any Word ! (Mar '11) 36 min Lucy the First 6,387
All Christmas Carols/Songs and Quotes.. 3 hr Grace Nerissa 44
News Church fined $12,000 for helping homeless new 3 hr Spotted Girl 41
More from around the web