The Tocharians were originally Q1b an...

The Tocharians were originally Q1b and B Rh negative Jews.

Posted in the Weird Forum

Level 2

Since: Dec 12

Location hidden

#1 Jan 9, 2013
According to the 2010 recent literature "Extended Y-chromosome investigation _Suggests_ to post-Glacial migrations of modern that perfecting a into East Asia via the northern route," reports, the research team in Xinjiang No. 106 sites 18 cases Uighur samples measured five cases Q1b-M378 and in Xinjiang No. 105 locations in 71 specimens, measured one cases Q1b-M378, but not seen Q1b-M378 in the Uighur samples of 104 and 107 at two locations, and other ethnic groups examined samples nor See Q1b-M378. From the previously published literature, no the domestic ethnic measured to Q1b-M378. It would appear that in China Q1b-M378 is focused on a specific ethnic group in Xinjiang.

Q1a 3b Subeshi Witches or Tocharian-Jewish or Lilith arrive to the Tamir Basin 3800 years ago from Ur Sumeria ...

This is the real Rhiannon or Lilith, Tall, Jewish Nose, Red Hair, Green Eye, Witch, Witch Hat, and B Rh negative Jewish-Celtic Witch an pure Cacacasian with Q1b same as the father all Jews Abraham and ...

Rev: 5'-3'= actatacttcttttgtgtgccttc (SEQ ID NO: 801) M271 = UTY1 intron 17 3679-566 (461 bp) A to C at position 296 GroupVIII. Discovered while typing M232

[Comparative investigation of the Rh blood type distribution between the Uygur and Han nationalities in the Khotan area of Xinjiang Autonomous Region].
[Article in Chinese]
Kurexijiang T, Hamulati W, Nuermaimaiti Y, Muyasaier K, Palida Habaer R, Halike Y, Meilike Y, Zhang LZ, Maimaitiabula A.
People's Hospital of Hetian County, Hetian 848100, Xinjiang Autonomous Region, China.

To investigate the Rh blood type distribution in the Uygur and Han nationalities in Khotan area of Xinjiang Autonomous Region, China, and compare the results with previous documentations on the Rh blood type in Uighurs.

Using epidemiological methods, an extensive survey was conducted for determination of the Rh blood type in 2,907 residents in the target area, including 2,251 Uighurs and 656 subjects of Han nationality. Positive definition method was used for the ABO blood typing while Rh blood type was determined serologically through saline medium method. At the same time, the Rh phenotypes were investigated in RhD-negative individuals.

Altogether 106 RhD-negative individuals were identified, accounting for a rate of 4.71% in this cohort, with the D gene frequency of 0.217. The Rh phenotype of all RhD-negative cases were ccdee except for one that was ccdEe. When compared with the previous ABO blood type distribution data of the Uighurs in randomly chosen samples, B type in RhD-negative individuals was relatively higher while A and O types peared lower.
The Rh blood type frequency is relatively higher in the Uighurs with unique Rh phenotypes.

Level 2

Since: Dec 12

Location hidden

#2 Jan 9, 2013
Q1a3b M323 (Yemenite Jews only)

Rhiannon or Lilith the Tocharian cannot marry mortals of she will lose her powers but she married me in Ur Sumerian the homeland of the Gutian-Tocharian with B Rh negative both Arbaham father of Jews or Ahura Mazda with Q1a3b Gutian-Tocharian and Lilith or Belita the Mother of all were both with Q1a3b Gutian-Tocharian and B Rh negative people from the Tamir Basin in China
Historical Aspect:
The Yemeni Jews formation: in Yemenite Jews
6. Q1b Q1b into Caucasians, mainly in Europe, also has some distribution in Xinjiang, China, South Asia, North Africa. The figure above the main migratory routes is a reference to a European direction Q distribution A detailed map and do. Facebook Q1b one user said: the his ancestors sources is about 3,000 years movement from the eastern Mediterranean, the Levant and North Africa, a family.
Historical Aspect: Ashkenazi Jews ( Ashkenazi, Jewish ) Zionism Jews ( Mizrachi Jewish ), the Iberian Peninsula, Jews ( Sephardi Jewish ), the Ashina Turkic people, the Vikings, Vikings, Masonic
Q1b as a unique genetic markers, and may be related with the Green Turkic Ashina's Khazar Asna's Ashkenazi Jews, has attracted wide attention. Familytreedna subjects to establish a "ASHINA / A-SHIH-NA / ASENA ROYALTY (OF GOKTURKS AND KHAZARS) DNA" (translated: young Turks and Khazar royal A History of Nashi DNA) project, has brought together 43 cases Q1b samples (some of which are not measured defined Q1b SNP loci STR structure speculate Q1b M378)(connection). At the same time, some subjects were established "Jewish_Q - YDNA Haplogroup Q1b of European Descent" (translated: Jews _Q: European descent, Y-DNA the haploid group Q1b), currently brings together 134 cases Q1b or suspected Q1b samples (connection).
172 This study Xinjiang Uygur Q1b-M378 Q1b 13 12 14 16 21 10 15 13
173 This study Xinjiang Uygur Q1b-M378 Q1b 13 12 13 16 22 10 15 13
174 Sengupta,et al.2006 Pakistan_North Q1b-M378 Q1b 13 12 13 16 22 10 15 13
175 Sengupta,et al.2006 Pakistan_South Q1b-M378 Q1b 13 12 14 16 22 10 15 13

Level 2

Since: Dec 12

Location hidden

#3 Jan 9, 2013
Q1b-M378 Armenian or Kurdish Jewish Marker

Level 2

Since: Dec 12

Location hidden

#4 Jan 9, 2013
According to the 2010 recent literature "Extended Y-chromosome investigation _Suggests_ to post-Glacial migrations of modern that perfecting a into East Asia via the northern route," reports, the research team in Xinjiang No. 106 sites 18 cases Uighur samples measured five cases Q1b-M378 and in Xinjiang No. 105 locations in 71 specimens, measured one cases Q1b-M378, but not seen Q1b-M378 in the Uighur samples of 104 and 107 at two locations, and other ethnic groups examined samples nor See Q1b-M378. From the previously published literature, no the domestic ethnic measured to Q1b-M378. It would appear that in China Q1b-M378 is focused on a specific ethnic group in Xinjiang.
2009 literature "A Y-STR database of Iranian and Azerbaijanian minority populations" reports, the researchers were 46 cases of ethnic minorities in Iran, Arab sample, 46 cases Bakhtiari samples in each of the 43 cases Talysh samples found in 1 case Q1b.

2009 Another paper, "Local Population Structure in Arabian Peninsula Revealed by Y-STR Diversity" reported that the UAE sample of 217 cases, the researchers found three cases Q1b, and found 104 cases of Iranian sample one cases Q1b.
According to the 2010 recent literature "Extended Y-chromosome investigation _Suggests_ to post-Glacial migrations of modern that perfecting a into East Asia via the northern route," reports, the research team in Xinjiang No. 106 sites 18 cases Uighur samples measured five cases Q1b-M378 and in Xinjiang No. 105 locations in 71 specimens, measured one cases Q1b-M378, but not seen Q1b-M378 in the Uighur samples of 104 and 107 at two locations, and other ethnic groups examined samples nor See Q1b-M378. From the previously published literature, no the domestic ethnic measured to Q1b-M378. It would appear that in China Q1b-M378 is focused on a specific ethnic group in Xinjiang.

2009 literature "A Y-STR database of Iranian and Azerbaijanian minority populations" reports, the researchers were 46 cases of ethnic minorities in Iran, Arab sample, 46 cases Bakhtiari samples in each of the 43 cases Talysh samples found in 1 case Q1b.

Sasan the brother of the Darius III became a Shepherd in the Baktiarin region with Q1b-M278 that became the L-M11 haplogroup the mtDNA Sassanian Nobles when LM20 of the Elamites or Magi priest or Medes mixed with Jewish Persian of Sasan Q1b-M278 became the Parsis Noble Royal and Priestly class Sassanians in 200 A.D. when the Parsi Priesthood began 1800 years ago. Sasan descend from Darius and Cyrus the Great and he was the Jewish Q1b-M278 which came from Esther who Cyrus the Great Wife and Darius I who was their son. My Grandfather Major Frank Warren has the Parsis mtdna Nobles form Parsis L-M11 haplogroup with B rh negative both who came Nazbanu the daughter of Yazdegerd III daughter mtDNA L* and B Rh negative types.

Q1b caused widespread concern from the 2004 literature "Y chromosome evidence for a founder effect in Ashkenazi Jews", this article analyzed 495 cases of Ashkenazi Jewish paternal genetic deconstruction results found Q1b occurrence frequency of 5%, it is also measured to a certain percentage of the East Eurasian haplotype C, N, and therefore, presumably Q1b may be related to the East Eurasian populations. A the ASHG 2010 Conference literature "Population Genetic Analysis of a Large Ashkenazi, Jewish" According to a summary, the researchers detected a large sample of more than 1000 cases of Ashkenazi Jews, but unfortunately has been no original contains not clear how much Q1b sample .

When compared with the previous ABO blood type distribution data of the Uighurs in randomly chosen samples, B type in RhD-negative individuals was relatively higher while A and O types peared lower.

Level 2

Since: Dec 12

Location hidden

#5 Jan 9, 2013
L-M11 haplogroup in Parsis and Rudari Gypsies is directly related Q1b-M287 and Q1a3b and B Rh negative in Tocharian-Gutians or people of Kur the Underworld or Kurdistan and purest of the purest are Kurdish Yazidis and Kurdish Jews.

Q1b-M287 is Armenian Jewish or Kurdish Yazidi Jewish Marker.

Level 2

Since: Dec 12

Location hidden

#6 Jan 9, 2013
Q1a3b Abraham was Ahura Mazda the Gutian-Tocharian and pure Yazidi.

Level 2

Since: Dec 12

Location hidden

#7 Jan 9, 2013
SOON after the death of Salih, the prophet Abraham was born at Susa, or, according to others, at Babylon. He was a contemporary of the mighty king, Nimrod,

Abraham was born in Susa so was Varuna who is Ahura Mazda the Gutian from Kur or Susa in the Zagros Mountian. Abraham was black Gutian Elamite. How do I know because I saw in August 12th 2003 walking up my street when I was driving in a car with ebony black skin with hair comb back like a brahmin with white like Greek like Toga and was not very tall, he was very old, skinny man with ebony black skin, caucasian face and caucasian nose and thin lips, stern face, raven look and he was wearing saddles and carry book of spell, Astrology, Astromny know as Kabbalah by the Jews.

Q1a3b Abraham is Varuna or Ahura Mazda the Gutian-Tocharian and pure Yazidi from Susa or Kur

The last thing Semitic Jews and Semitic Aryan wanted to or hear about is a sighting of Abraham or Lilith because Abraham is Samael to Semitic and Belita the is Lilith. Both real father and Mother all Jews and Gypsies and Atlantean people.
Sumerian RH

Huntington, NY

#8 Jan 9, 2013
What were the Kardashians? Originally?

Level 2

Since: Dec 12

Location hidden

#9 Jan 9, 2013
Lom Gypsies, just the Rudari in Romania and Shah Pahlavi family were Lom Armerian Gypsies and the Lom with L*haplogroup and B Rh negative are not Parsis from Karachi but Persian Royalty from Pars Persia that going back to the Sassanians
Sumerian RH

Huntington, NY

#10 Jan 9, 2013
King of Atlantis wrote:
Lom Gypsies, just the Rudari in Romania and Shah Pahlavi family were Lom Armerian Gypsies and the Lom with L*haplogroup and B Rh negative are not Parsis from Karachi but Persian Royalty from Pars Persia that going back to the Sassanians
I said KARDASHIANS, not Sassanians!!!!

Clean your water-logged ears!!!!!

Level 2

Since: Dec 12

Location hidden

#11 Jan 9, 2013
if Kim Kardashian is Lom Armenian Gypsies like Rudari in Romania, Lom in Eastern Turkey and Lom in Armenia and Lom in Caucasian and she is B Blood type and Gypsy and if you she B Rh negative the she is infact Sassanian Nobel Royalty. Just because you are not a Sassanian Nobility doesn't mean she is not. You shouldn't be such hater!

Level 2

Since: Dec 12

Location hidden

#12 Jan 9, 2013
Sumerian Rh and all the other made of names? real sound like you working for the government and you try to embarass somebody! or you are a SemeticJewish you don't like what same about truth about Abraham or you a fake Nazi and you think the people of Persian royalty is Brad Pitt? Yah Keep dreaming!

“We're all Bozos on this bus”

Since: Jan 07

South Bend, IN

#13 Jan 9, 2013
Hot time Sumerian the city. Back of my neck getting dirt and gritty.

“the Democrats have become”

Since: Jun 08

the Party of NO!!!..their turn

#14 Jan 9, 2013
...well....i'm glad all that is straightened out can resume...

United States

#15 Jan 9, 2013
King of Atlantis wrote:
Sumerian Rh and all the other made of names? real sound like you working for the government and you try to embarass somebody! or you are a SemeticJewish you don't like what same about truth about Abraham or you a fake Nazi and you think the people of Persian royalty is Brad Pitt? Yah Keep dreaming!
Do you perform at kid's parties?

United States

#16 Jan 9, 2013
Old Sam wrote:
...well....i'm glad all that is straightened out can resume...
Hardly. Now I need treatment for an acute SPAM allergy.
Crusty The Clown

Huntington, NY

#17 Jan 9, 2013
Curious wrote:
<quoted text>Do you perform at kid's parties?
Yes, they call him in at the end of the party when they want the kids to leave immediately.

Tell me when this thread is updated:

Subscribe Now Add to my Tracker

Add your comments below

Characters left: 4000

Please note by submitting this form you acknowledge that you have read the Terms of Service and the comment you are posting is in compliance with such terms. Be polite. Inappropriate posts may be removed by the moderator. Send us your feedback.

Weird Discussions

Title Updated Last By Comments
Two words only please! (Aug '08) 1 min KNIGHT DeVINE 40,887
News Evolution vs. Creation (Jul '11) 2 min scientia potentia... 217,067
Word Association 2 (Sep '13) 3 min KNIGHT DeVINE 22,249
last word/first word. (Apr '12) 5 min beatlesinthebog 7,114
What turns you on ? (Aug '11) 8 min KNIGHT DeVINE 1,537
What song are you listening to right now? (Apr '08) 8 min Foreign Approach 207,312
Last Word is First Word (no "breast" word please) (Jul '15) 8 min beatlesinthebog 1,486
What Turns You Off (Jun '11) 13 min Lucy the First 10,663
El's Kitchen (Feb '09) 51 min _Susan_ 67,283
Poll What are you thinking right now? (May '08) 7 hr Lucy the First 2,483
More from around the web