Formula to form Jews, Gypsies, Germans to form there own pure Caucasian Caste.

Posted in the Weird Forum

Comments

Showing posts 1 - 4 of4
Man from Atlantis

North Charleston, SC

|
Report Abuse
|
Judge it!
|
#1
Apr 8, 2013
 

Judged:

1

1

Formula to form Jews, Gypsies, Germans and Amerindian to form there own pure Caucasian Caste.
Formula to form Jews, Gypsies, Germans and Amerindian to form there own pure Caucasian Caste.
fbo1b3-b4-b5 rh-cde or Rh ryr with DRB3*0101 and DR52a or Pure Rh ryr A- and B- Rh negative with also carry Laron Syndrome of B Rh negative with H3 haplogroup or subtype 271
GHRH-R or insensitive Laron Syndrome protect against various cancers.
DRB3*0101 and DR52a from Gorrilla or Homo Erectus Neanderthal
B blood some protect against HIV
B Rh negative have great protect agianst HIV
mtDNA L-M11 trace roots to Darius the Great of Persia and Zoroaster Arianoi or pure Aryan.

DRB1*0802 trace to Blackfeet Sioux and Mayan Amerindians.
Rh ryr trace to Native American Rh negative people such as Aluet who B- Rh negative, Blackfeet Indian who are A- Rh ryr negative and Andes Indian who B- Rh ryr negatives.
In Asia it is the Japanese Ural-Altaic (ighg 1G3 fbo1b3-b4-b5 rh-cde or Rh ryr with DRB3*0101 and DR52a or Pure Rh ryr A- or pure Caucasian race people.
GTCGCTTC) with L-M11 is related to actatacttcttttgtgtgccttc (SEQ ID NO: 801 is related Yemenite Jews
M271 is a new member of Subgroup H3. H3 haplogroup came from pure Jews with both L and Q haplogroup with M271 which people with L-M11 haplgroup has the same Highly protective against AIDS progression.
GTCGCTTC) with L-M11 is related to actatacttcttttgt(GTCGCTTC )(SEQ ID NO: 801 is related Yemenite Jews and
GTCGCTTC Major Frank Warren L haplogroup mtDNA sequence for Dwarfism of Sindh. Neoteny
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B genes is responsible for pupation (the stage in the development of an insect in which it lies in repose and from which it eventually emerges in the winged form) in
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty which people like me reach maturation at the age of years old. The gene is called GHRH-R which was Yemenite Jews carried to Ur Sumeria and to Persian Sassanian Royal with Exilarch Jewish(Yemenite Jews blood of Solomon and Sheba son Menelik. Nazbanu the daughther of Yazdegerd III from Pars carried L-M11 with TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B trigger male-limited precious puberty to Deval or Karachi in Sindh Province in now Pakistan is now called the Dwarfism of Sindh which is Male-Limited Precious Puberty without Luten related causes.
TGGTCATCCTTT(GTCGCTTC)(sense, position 759) Sp38-40.B came from Mayan Indian which they got from the axolotl or Giant Tadpole which have Male-Limited Precious Puberty
TGGTCATCCTTTGTCGCTTC (sense, position 759)
Chironomus tentans 7108 7153 3959 C.tentans Sp38-40.A and Sp38-40.B genes.
mtDNA 271 or 16271 in found in the Semang in Malaysia

H3 represents a smaller fraction of European genome than H1 but has a somewhat similar distribution with peak among Basques (13.9%), Galicians (8.3%) and Sardinians (8.5%). Its importance decreases towards the northeast of the continent though.[1] Studies have suggested haplogroup H3 is highly protective against AIDS progression.[12]
M271 is a new member of Subgroup H3.
mtDNA M271 originated Mainland Southeast Asia Negritos with the CDe or fa;b0b2b3b4b5tCDe found both in Malaysia Negritos and Amerindians.
With this Formula you with pure Caucasian Neanderthal Rh negative blood with various protection natural protect with Cancers and HIV and pure Aryan features form the Jews.
You have foutain of youth because you will have GHRH-R or insensitive Laron Syrdome which will normal child protection and but maturation will occur at the of 2 or 3 years old and young and old charatheristic will be totally preserved for life. You will age very slowly and live longer and with all the protect of against HIV and Cancers and other diseases. You will be a Super no African no Chimpanzee race of people.
Man from Atlantis

North Charleston, SC

|
Report Abuse
|
Judge it!
|
#2
Apr 8, 2013
 
J1b trace to the Sumerians Ychromosome Jewish Exilarch or King all the Jewish and tribe of Judah and Benjamin.
B Rh negative traces to tribe of Judah and Benjamin, Lilith, Samael, or Anahita or Ahura Mazda, Daniel or Zerubbabel and Virgin Mary.
Briggs And Stratton

Patchogue, NY

|
Report Abuse
|
Judge it!
|
#3
Apr 8, 2013
 

Judged:

1

1

Although a two-stroke engine has less moving parts than a four-stroke engine, a two-stroke is a complex engine because it relies on gas dynamics. There are different phases taking place in the crankcase and in the cylinder bore at the same time. That is how a two-stroke engine completes a power cycle in only 360 degrees of crankshaft rotation compared to a four-stroke engine which requires 720 degrees of crankshaft rotation to complete one power cycle. These four drawings give an explanation of how a two-stroke engine works.

1) Starting with the piston at top dead center (TDC 0 degrees) ignition has occurred and the gasses in the combustion chamber are expanding and pushing down the piston. This pressurizes the crankcase causing the reed valve to close. At about 90 degrees after TDC the exhaust port opens ending the power stroke. A pressure wave of hot expanding gasses flows down the exhaust pipe. The blow-down phase has started and will end when the transfer ports open. The pressure in the cylinder must blow-down to below the pressure in the crankcase in order for the unburned mixture gasses to flow out the transfer ports during the scavenging phase.

2) Now the transfer ports are uncovered at about 120 degrees after TDC. The scavenging phase has begun. Meaning that the unburned mixture gasses are flowing out of the transfers and merging together to form a loop. The gasses travel up the back side of the cylinder and loops around in the cylinder head to scavenge out the burnt mixture gasses from the previous power stroke. It is critical that the burnt gasses are scavenged from the combustion chamber, in order to make room for as much unburned gasses as possible. That is the key to making more power in a two-stroke engine. The more unburned gasses you can squeeze into the combustion chamber, the more the engine will produce. Now the loop of unburned mixture gasses have traveled into the exhaust pipe's header section. The gasses aren't lost because a compression pressure wave has reflected from the end of the exhaust pipe, to pack the unburned gasses back into the cylinder before the piston closes off the port. This is the unique super-charging effect of two-stroke engines. The main advantage of two-stroke engines is that they can combust more volume of fuel/air mixture than the swept volume of the engine. Example: A 125cc four-stroke engine combusts about 110cc of F/A gasses but a 125cc two-stroke engine combusts about 180cc of F/A gasses.

3) Now the crankshaft has rotated past bottom dead center (BDC 180 degrees) and the piston is on the upstroke. The compression wave reflected from the exhaust pipe is packing the unburned gasses back in through the exhaust port as the piston closes off the port the start the compression phase. In the crankcase the pressure is below atmospheric producing a vacuum and a fresh charge of unburned mixture gasses is flowing through the reed valve into the crankcase.

4) The unburned mixture gasses are compresses and just before the piston reaches TDC, the ignition system discharges a spark causing the gasses to ignite and start the process all over again.
Briggs And Stratton

Patchogue, NY

|
Report Abuse
|
Judge it!
|
#4
Apr 8, 2013
 

Judged:

1

1

The cylinder ports are designed to produce a certain power characteristic over a fairly narrow rpm band. Porting or tuning is a metal machining process performed to the cylinder ports (exhaust & transfers) that alters the timing, area size, and angles of the ports in order to adjust the power band to better suit the rider's demands. For example, a veteran trail rider riding an RM250 in the Rocky mountain region of the USA will need to adjust the power band for more low end power because of the steep hill climbs and the lower air density of higher altitudes. The only way to determine what changes will be needed to the engine is by measuring and calculating the stock engine's specifications. The most critical measurement is termed port-time-area. This term is a calculation of a port's size area and timing in relation to the displacement of the engine and the rpm. Experienced tuners know what the port-time-area values of the exhaust and transfer ports should be for an engine used for a particular purpose. In general, if a tuner wants to adjust the engine's power band for more low to mid range he would do the following things. Turn down the cylinder base on a lathe to increase the effective stroke (distance from TDC to exhaust port opening). This also retards the exhaust port timing and shortens the duration and increases the compression ratio. Next the transfer ports should be narrowed and re-angled with epoxy to reduce the port-time-area for an rpm peak of 7,000 rpm. The rear transfer ports need to be re-angled so they oppose each other rather than pointing forward to the exhaust port. This changes the loop scavenging flow pattern of the transfer ports to improve scavenging efficiency at low to mid rpm (2,000 to 5,000 rpm). An expert rider racing mx in England would want to adjust the power band of an RM250 for more mid to top end power. The cylinder would need to be tuned radically different than for trail riding.

Here is an example. The exhaust port would have to be raised and widened to change the port-time-area peak for a higher rpm (9,000 rpm). For either of these cylinder modifications to be effective, other engine components would also need to be changed to get the desired tuning effect.

Tell me when this thread is updated: (Registration is not required)

Add to my Tracker Send me an email

Showing posts 1 - 4 of4
Type in your comments below
Name
(appears on your post)
Comments
Characters left: 4000
Type the numbers you see in the image on the right:

Please note by clicking on "Post Comment" you acknowledge that you have read the Terms of Service and the comment you are posting is in compliance with such terms. Be polite. Inappropriate posts may be removed by the moderator. Send us your feedback.

•••
•••